lentiviral system Search Results


90
OriGene pcmv6 entry cbx3 myc ddk
Pcmv6 Entry Cbx3 Myc Ddk, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+system/Cbx3+(NM_007624)+Mouse+Tagged+ORF+Clone+Lentiviral+Particle/pm33731112-114-21-27
Average 90 stars, based on 1 article reviews
pcmv6 entry cbx3 myc ddk - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OriGene ralb
<t>RALA,</t> but not <t>RALB,</t> promotes metastatic growth in spontaneous and experimental models of TNBC lung metastasis. a Representative images (top) and quantitation (bottom) of lungs harvested from mice bearing MDA-MB-231 Ctrl ( n = 5), RALA-KO ( n = 6), or RALB-KO ( n = 6) tumors. Lungs were harvested when early removal criteria (ERC) was reached for each respective cohort. Scale bar is 100μm. b Representative H&E images and quantification of lung metastases arising in mice bearing orthotopic MVT1 shCtrl ( n = 6) or shRALA ( n = 6) mammary tumors. Lung metastasis were categorized as nodules, foci, or emboli. Representative images of each category are shown. Scale bars are 50μm except for the representative foci image which is 20μm. All mice were sacrificed when the shCtrl group met ERC. c Experimental metastasis assay. Representative IVIS images and quantification of total flux in the lungs of mice following tail vein inoculation of luciferase-tagged MDA-MB-231 shCtrl ( n = 15) or shRALA ( n = 10) cells over 24 days. e Extravasation and early colonization assay. Representative IVIS images and quantification of total flux in the lungs of mice following tail vein inoculation of luciferase-tagged MDA-MB-231 shCtrl ( n = 13) or shRALA ( n = 11) cells over 96 h. Data are presented as mean ± SEM; (*), P < 0.05
Ralb, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+system/RALB+Human+shRNA+Lentiviral+Particle/pmc08196523-57-63-77
Average 90 stars, based on 1 article reviews
ralb - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
OriGene tl309246v
<t>RALA,</t> but not <t>RALB,</t> promotes metastatic growth in spontaneous and experimental models of TNBC lung metastasis. a Representative images (top) and quantitation (bottom) of lungs harvested from mice bearing MDA-MB-231 Ctrl ( n = 5), RALA-KO ( n = 6), or RALB-KO ( n = 6) tumors. Lungs were harvested when early removal criteria (ERC) was reached for each respective cohort. Scale bar is 100μm. b Representative H&E images and quantification of lung metastases arising in mice bearing orthotopic MVT1 shCtrl ( n = 6) or shRALA ( n = 6) mammary tumors. Lung metastasis were categorized as nodules, foci, or emboli. Representative images of each category are shown. Scale bars are 50μm except for the representative foci image which is 20μm. All mice were sacrificed when the shCtrl group met ERC. c Experimental metastasis assay. Representative IVIS images and quantification of total flux in the lungs of mice following tail vein inoculation of luciferase-tagged MDA-MB-231 shCtrl ( n = 15) or shRALA ( n = 10) cells over 24 days. e Extravasation and early colonization assay. Representative IVIS images and quantification of total flux in the lungs of mice following tail vein inoculation of luciferase-tagged MDA-MB-231 shCtrl ( n = 13) or shRALA ( n = 11) cells over 96 h. Data are presented as mean ± SEM; (*), P < 0.05
Tl309246v, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+system/SNF5+(SMARCB1)+Human+shRNA+Lentiviral+Particle/us12473334-924-41-46
Average 93 stars, based on 1 article reviews
tl309246v - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
OriGene ahr myc ddk tagged plasmid
<t>RALA,</t> but not <t>RALB,</t> promotes metastatic growth in spontaneous and experimental models of TNBC lung metastasis. a Representative images (top) and quantitation (bottom) of lungs harvested from mice bearing MDA-MB-231 Ctrl ( n = 5), RALA-KO ( n = 6), or RALB-KO ( n = 6) tumors. Lungs were harvested when early removal criteria (ERC) was reached for each respective cohort. Scale bar is 100μm. b Representative H&E images and quantification of lung metastases arising in mice bearing orthotopic MVT1 shCtrl ( n = 6) or shRALA ( n = 6) mammary tumors. Lung metastasis were categorized as nodules, foci, or emboli. Representative images of each category are shown. Scale bars are 50μm except for the representative foci image which is 20μm. All mice were sacrificed when the shCtrl group met ERC. c Experimental metastasis assay. Representative IVIS images and quantification of total flux in the lungs of mice following tail vein inoculation of luciferase-tagged MDA-MB-231 shCtrl ( n = 15) or shRALA ( n = 10) cells over 24 days. e Extravasation and early colonization assay. Representative IVIS images and quantification of total flux in the lungs of mice following tail vein inoculation of luciferase-tagged MDA-MB-231 shCtrl ( n = 13) or shRALA ( n = 11) cells over 96 h. Data are presented as mean ± SEM; (*), P < 0.05
Ahr Myc Ddk Tagged Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+system/Ahr+(NM_013149)+Rat+Tagged+ORF+Clone+Lentiviral+Particle/10__1158_slash_1535___7163__mct___21___0841-51-13-27
Average 90 stars, based on 1 article reviews
ahr myc ddk tagged plasmid - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
OriGene lentiviral 505 vector
<t>RALA,</t> but not <t>RALB,</t> promotes metastatic growth in spontaneous and experimental models of TNBC lung metastasis. a Representative images (top) and quantitation (bottom) of lungs harvested from mice bearing MDA-MB-231 Ctrl ( n = 5), RALA-KO ( n = 6), or RALB-KO ( n = 6) tumors. Lungs were harvested when early removal criteria (ERC) was reached for each respective cohort. Scale bar is 100μm. b Representative H&E images and quantification of lung metastases arising in mice bearing orthotopic MVT1 shCtrl ( n = 6) or shRALA ( n = 6) mammary tumors. Lung metastasis were categorized as nodules, foci, or emboli. Representative images of each category are shown. Scale bars are 50μm except for the representative foci image which is 20μm. All mice were sacrificed when the shCtrl group met ERC. c Experimental metastasis assay. Representative IVIS images and quantification of total flux in the lungs of mice following tail vein inoculation of luciferase-tagged MDA-MB-231 shCtrl ( n = 15) or shRALA ( n = 10) cells over 24 days. e Extravasation and early colonization assay. Representative IVIS images and quantification of total flux in the lungs of mice following tail vein inoculation of luciferase-tagged MDA-MB-231 shCtrl ( n = 13) or shRALA ( n = 11) cells over 96 h. Data are presented as mean ± SEM; (*), P < 0.05
Lentiviral 505 Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+system/Alkaline+Phosphatase+(ALPL)+(NM_000478)+Human+Tagged+ORF+Clone+Lentiviral+Particle/pm40340250-225-11-15
Average 93 stars, based on 1 article reviews
lentiviral 505 vector - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
OriGene pcmv6 entry mouse mlh1 origene
Figure 1. <t>MLH1</t> Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.
Pcmv6 Entry Mouse Mlh1 Origene, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+system/Mlh1+(NM_026810)+Mouse+Tagged+ORF+Clone+Lentiviral+Particle/pm33338427-205-151-153
Average 90 stars, based on 1 article reviews
pcmv6 entry mouse mlh1 origene - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

taz  (OriGene)
90
OriGene taz
Figure 4: Loss of Lats <t>and</t> <t>YAP</t> Phosphorylation, Increased <t>TAZ</t> Levels with PCBP2 652
Taz, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+system/Taz+Rat+shRNA+Lentiviral+Particle/10__1128_slash_mcb__00104___16-32-0-8
Average 90 stars, based on 1 article reviews
taz - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

91
OriGene overexpression system pan02oe ctl
Figure 4: Loss of Lats <t>and</t> <t>YAP</t> Phosphorylation, Increased <t>TAZ</t> Levels with PCBP2 652
Overexpression System Pan02oe Ctl, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+system/Nlrx1+(NM_001163743)+Mouse+Tagged+ORF+Clone+Lentiviral+Particle/pm37342194-58-29-32
Average 91 stars, based on 1 article reviews
overexpression system pan02oe ctl - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

90
OriGene ogdhl myc ddk
Figure 4: Loss of Lats <t>and</t> <t>YAP</t> Phosphorylation, Increased <t>TAZ</t> Levels with PCBP2 652
Ogdhl Myc Ddk, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+system/OGDHL+(NM_018245)+Human+Tagged+ORF+Clone+Lentiviral+Particle/pm36295907-103-25-26
Average 90 stars, based on 1 article reviews
ogdhl myc ddk - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OriGene full length recombinant hankrd1
Figure 4: Loss of Lats <t>and</t> <t>YAP</t> Phosphorylation, Increased <t>TAZ</t> Levels with PCBP2 652
Full Length Recombinant Hankrd1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+system/Ankrd1+(NM_013220)+Rat+Tagged+ORF+Clone+Lentiviral+Particle/pmc08024308__42003_2021_1965_MOESM2_ESM-93-12-15
Average 90 stars, based on 1 article reviews
full length recombinant hankrd1 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

92
OriGene lentidnmt3b
Figure 4: Loss of Lats <t>and</t> <t>YAP</t> Phosphorylation, Increased <t>TAZ</t> Levels with PCBP2 652
Lentidnmt3b, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+system/Dnmt3b+(NM_001003961)+Mouse+Tagged+ORF+Clone+Lentiviral+Particle/pm38057952-288-2-4
Average 92 stars, based on 1 article reviews
lentidnmt3b - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

92
OriGene gasdermin
Figure 4: Loss of Lats <t>and</t> <t>YAP</t> Phosphorylation, Increased <t>TAZ</t> Levels with PCBP2 652
Gasdermin, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+system/Gasdermin+like+(GSDMB)+(NM_001042471)+Human+Tagged+ORF+Clone+Lentiviral+Particle/pm38514093-250-20-28
Average 92 stars, based on 1 article reviews
gasdermin - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

Image Search Results


RALA, but not RALB, promotes metastatic growth in spontaneous and experimental models of TNBC lung metastasis. a Representative images (top) and quantitation (bottom) of lungs harvested from mice bearing MDA-MB-231 Ctrl ( n = 5), RALA-KO ( n = 6), or RALB-KO ( n = 6) tumors. Lungs were harvested when early removal criteria (ERC) was reached for each respective cohort. Scale bar is 100μm. b Representative H&E images and quantification of lung metastases arising in mice bearing orthotopic MVT1 shCtrl ( n = 6) or shRALA ( n = 6) mammary tumors. Lung metastasis were categorized as nodules, foci, or emboli. Representative images of each category are shown. Scale bars are 50μm except for the representative foci image which is 20μm. All mice were sacrificed when the shCtrl group met ERC. c Experimental metastasis assay. Representative IVIS images and quantification of total flux in the lungs of mice following tail vein inoculation of luciferase-tagged MDA-MB-231 shCtrl ( n = 15) or shRALA ( n = 10) cells over 24 days. e Extravasation and early colonization assay. Representative IVIS images and quantification of total flux in the lungs of mice following tail vein inoculation of luciferase-tagged MDA-MB-231 shCtrl ( n = 13) or shRALA ( n = 11) cells over 96 h. Data are presented as mean ± SEM; (*), P < 0.05

Journal: Breast Cancer Research : BCR

Article Title: The small G-protein RalA promotes progression and metastasis of triple-negative breast cancer

doi: 10.1186/s13058-021-01438-3

Figure Lengend Snippet: RALA, but not RALB, promotes metastatic growth in spontaneous and experimental models of TNBC lung metastasis. a Representative images (top) and quantitation (bottom) of lungs harvested from mice bearing MDA-MB-231 Ctrl ( n = 5), RALA-KO ( n = 6), or RALB-KO ( n = 6) tumors. Lungs were harvested when early removal criteria (ERC) was reached for each respective cohort. Scale bar is 100μm. b Representative H&E images and quantification of lung metastases arising in mice bearing orthotopic MVT1 shCtrl ( n = 6) or shRALA ( n = 6) mammary tumors. Lung metastasis were categorized as nodules, foci, or emboli. Representative images of each category are shown. Scale bars are 50μm except for the representative foci image which is 20μm. All mice were sacrificed when the shCtrl group met ERC. c Experimental metastasis assay. Representative IVIS images and quantification of total flux in the lungs of mice following tail vein inoculation of luciferase-tagged MDA-MB-231 shCtrl ( n = 15) or shRALA ( n = 10) cells over 24 days. e Extravasation and early colonization assay. Representative IVIS images and quantification of total flux in the lungs of mice following tail vein inoculation of luciferase-tagged MDA-MB-231 shCtrl ( n = 13) or shRALA ( n = 11) cells over 96 h. Data are presented as mean ± SEM; (*), P < 0.05

Article Snippet: Small interfering RNA (siRNA)-mediated knockdown of RALA and RALB was achieved through the transfection of MDA-MB-231 or MDA-MB-468 cells with 50 pMol of siRNA targeting human RALA (GCAGACAGCUAUCGGAAGA; Dharmacon, Lafayette, CO, USA), RALB (GAAAGAUGUUGCUUACUAU, Dharmacon) or simultaneously targeting both isoforms (GAGCUAAUGUUGACAAGGU; Dharmacon) or non-targeting control siRNA pool (D-001810-10-05, Dharmacon) using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA, USA) for 72 h. Human RALA (TL309957V) and RALB (TL309956V) targeting shRNA lentiviral particles and a non-targeting control (TR30021V) were purchased from OriGene (Rockville, MD, USA).

Techniques: Quantitation Assay, Luciferase

BQU57 blocks TNBC growth in vitro and in vivo. a Western blot and quantification of GTP-bound RALB in MDA-MB-231 cells after BQU57 (50μM) or DMSO treatment for 24 h. b Quantification of MDA-MB-231 and MVT1 cell viability upon treatment with varying doses of BQU57 for 72 h. c Quantification of MDA-MB-231 and MVT1 growth in low adhesion (GILA) conditions upon treatment with varying doses of BQU57 for 5 days. d Quantification of MDA-MB-231 orthotopic mammary tumor volume over time [ n = 9 DMSO; n = 10 BQU57 treatment (50mg/kg by i.p. injection, M-F)]. e Representative H&E images (left) and quantification (right) of spontaneous lung metastases in MDA-MB-231 tumor bearing mice following treatment (arrows point to metastatic lesions). Scale bars = 500μm. f Quantification of subcutaneous TNBC PDX tumor volume over time. [ n = 9 DMSO; n = 9 BQU57 treatment (50mg/kg, M-F)]. g Quantification of MDA-MB-231 cell viability upon treatment with BQU57 (100μM) or DMSO in combination with various doses of paclitaxel for 72 h. h RALA expression, but not RALB expression, is predictive of BC patient response to chemotherapy. Data from ROC Plotter. Data are presented as mean ± SEM; (*), P < 0.05

Journal: Breast Cancer Research : BCR

Article Title: The small G-protein RalA promotes progression and metastasis of triple-negative breast cancer

doi: 10.1186/s13058-021-01438-3

Figure Lengend Snippet: BQU57 blocks TNBC growth in vitro and in vivo. a Western blot and quantification of GTP-bound RALB in MDA-MB-231 cells after BQU57 (50μM) or DMSO treatment for 24 h. b Quantification of MDA-MB-231 and MVT1 cell viability upon treatment with varying doses of BQU57 for 72 h. c Quantification of MDA-MB-231 and MVT1 growth in low adhesion (GILA) conditions upon treatment with varying doses of BQU57 for 5 days. d Quantification of MDA-MB-231 orthotopic mammary tumor volume over time [ n = 9 DMSO; n = 10 BQU57 treatment (50mg/kg by i.p. injection, M-F)]. e Representative H&E images (left) and quantification (right) of spontaneous lung metastases in MDA-MB-231 tumor bearing mice following treatment (arrows point to metastatic lesions). Scale bars = 500μm. f Quantification of subcutaneous TNBC PDX tumor volume over time. [ n = 9 DMSO; n = 9 BQU57 treatment (50mg/kg, M-F)]. g Quantification of MDA-MB-231 cell viability upon treatment with BQU57 (100μM) or DMSO in combination with various doses of paclitaxel for 72 h. h RALA expression, but not RALB expression, is predictive of BC patient response to chemotherapy. Data from ROC Plotter. Data are presented as mean ± SEM; (*), P < 0.05

Article Snippet: Small interfering RNA (siRNA)-mediated knockdown of RALA and RALB was achieved through the transfection of MDA-MB-231 or MDA-MB-468 cells with 50 pMol of siRNA targeting human RALA (GCAGACAGCUAUCGGAAGA; Dharmacon, Lafayette, CO, USA), RALB (GAAAGAUGUUGCUUACUAU, Dharmacon) or simultaneously targeting both isoforms (GAGCUAAUGUUGACAAGGU; Dharmacon) or non-targeting control siRNA pool (D-001810-10-05, Dharmacon) using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA, USA) for 72 h. Human RALA (TL309957V) and RALB (TL309956V) targeting shRNA lentiviral particles and a non-targeting control (TR30021V) were purchased from OriGene (Rockville, MD, USA).

Techniques: In Vitro, In Vivo, Western Blot, Injection, Expressing

RALA, not RALB, is pro-tumorigenic in preclinical in vivo models of TNBC utilizing CRISPR mediated knockout of RALA/B. a Western blots demonstrating RALA and RALB expression in MDA-MB-231 CRISPR control (Ctrl), RALA CRISPR knockout (RALA-KO), and RALB CRISPR knockout (RALB-KO) cells. b Quantification of RALA and RALB expression in MDA-MB-231 Ctrl, RALA-KO, and RALB-KO cells by ImageJ analysis ( n = 3). c Representative images of RALA and RALB immunofluorescence staining in MDA-MB-231 Ctrl, RALA-KO and RALB-KO cells (red = RALA or RALB, blue = DAPI; scale bars = 20μm). d Quantification of MDA-MB-231 Ctrl ( n = 10), RALA-KO ( n = 8), and RALB-KO ( n = 12) orthotopic mammary tumor growth. e Representative images and H-score quantification of Ki67 immunostaining in MDA-MB-231 CRISPR Ctrl, RALA-KO, and RALB-KO orthotopic mammary tumors (scale bar = 40μm). f Representative images and H-score quantification of cleaved caspase 3 (CC3) immunostaining in MDA-MB-231 Ctrl, RALA-KO, and RALB-KO orthotopic mammary tumors (scale bar = 20μm). Data are presented as mean ± SEM; (*), P < 0.05

Journal: Breast Cancer Research : BCR

Article Title: The small G-protein RalA promotes progression and metastasis of triple-negative breast cancer

doi: 10.1186/s13058-021-01438-3

Figure Lengend Snippet: RALA, not RALB, is pro-tumorigenic in preclinical in vivo models of TNBC utilizing CRISPR mediated knockout of RALA/B. a Western blots demonstrating RALA and RALB expression in MDA-MB-231 CRISPR control (Ctrl), RALA CRISPR knockout (RALA-KO), and RALB CRISPR knockout (RALB-KO) cells. b Quantification of RALA and RALB expression in MDA-MB-231 Ctrl, RALA-KO, and RALB-KO cells by ImageJ analysis ( n = 3). c Representative images of RALA and RALB immunofluorescence staining in MDA-MB-231 Ctrl, RALA-KO and RALB-KO cells (red = RALA or RALB, blue = DAPI; scale bars = 20μm). d Quantification of MDA-MB-231 Ctrl ( n = 10), RALA-KO ( n = 8), and RALB-KO ( n = 12) orthotopic mammary tumor growth. e Representative images and H-score quantification of Ki67 immunostaining in MDA-MB-231 CRISPR Ctrl, RALA-KO, and RALB-KO orthotopic mammary tumors (scale bar = 40μm). f Representative images and H-score quantification of cleaved caspase 3 (CC3) immunostaining in MDA-MB-231 Ctrl, RALA-KO, and RALB-KO orthotopic mammary tumors (scale bar = 20μm). Data are presented as mean ± SEM; (*), P < 0.05

Article Snippet: Small interfering RNA (siRNA)-mediated knockdown of RALA and RALB was achieved through the transfection of MDA-MB-231 or MDA-MB-468 cells with 50 pMol of siRNA targeting human RALA (GCAGACAGCUAUCGGAAGA; Dharmacon, Lafayette, CO, USA), RALB (GAAAGAUGUUGCUUACUAU, Dharmacon) or simultaneously targeting both isoforms (GAGCUAAUGUUGACAAGGU; Dharmacon) or non-targeting control siRNA pool (D-001810-10-05, Dharmacon) using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA, USA) for 72 h. Human RALA (TL309957V) and RALB (TL309956V) targeting shRNA lentiviral particles and a non-targeting control (TR30021V) were purchased from OriGene (Rockville, MD, USA).

Techniques: In Vivo, CRISPR, Knock-Out, Western Blot, Expressing, Control, Immunofluorescence, Staining, Immunostaining

RALA, not RALB, is pro-tumorigenic in preclinical in vivo models of TNBC utilizing short hairpin knockdown of RALA/B. a Western blots demonstrating RALA and RALB expression in MDA-MB-231 shRNA control (shCtrl), shRALA, and shRALB cells. b Comparison of MDA-MB-231 shCtrl ( n = 5) and shRALA ( n = 5) orthotopic mammary tumor growth. c Comparison of MDA-MB-231 shCtrl ( n = 7) and shRALB ( n = 8) orthotopic mammary tumor growth. d Representative Ki67 immunostaining images and H-score quantification of MDA-MB-231 shCtrl ( n = 4) and shRALA ( n = 4) orthotopic mammary tumors. e Representative cleaved caspase 3 (CC3) immunostaining images and H-score quantification of MDA-MB-231 shCtrl ( n = 4) and shRALA ( n = 4) orthotopic mammary tumors. f Quantification of Rala mRNA expression in MVT1 shCtrl and shRALA cells by qRT-PCR (left) and growth of orthotopic mammary tumors (right; n =6 per group). Inset shows western blot confirmation of RALA protein expression in MVT1 shCtrl and shRALA cells. Data are presented as mean ± SEM; (*), P < 0.05; scale bars = 20μm

Journal: Breast Cancer Research : BCR

Article Title: The small G-protein RalA promotes progression and metastasis of triple-negative breast cancer

doi: 10.1186/s13058-021-01438-3

Figure Lengend Snippet: RALA, not RALB, is pro-tumorigenic in preclinical in vivo models of TNBC utilizing short hairpin knockdown of RALA/B. a Western blots demonstrating RALA and RALB expression in MDA-MB-231 shRNA control (shCtrl), shRALA, and shRALB cells. b Comparison of MDA-MB-231 shCtrl ( n = 5) and shRALA ( n = 5) orthotopic mammary tumor growth. c Comparison of MDA-MB-231 shCtrl ( n = 7) and shRALB ( n = 8) orthotopic mammary tumor growth. d Representative Ki67 immunostaining images and H-score quantification of MDA-MB-231 shCtrl ( n = 4) and shRALA ( n = 4) orthotopic mammary tumors. e Representative cleaved caspase 3 (CC3) immunostaining images and H-score quantification of MDA-MB-231 shCtrl ( n = 4) and shRALA ( n = 4) orthotopic mammary tumors. f Quantification of Rala mRNA expression in MVT1 shCtrl and shRALA cells by qRT-PCR (left) and growth of orthotopic mammary tumors (right; n =6 per group). Inset shows western blot confirmation of RALA protein expression in MVT1 shCtrl and shRALA cells. Data are presented as mean ± SEM; (*), P < 0.05; scale bars = 20μm

Article Snippet: Small interfering RNA (siRNA)-mediated knockdown of RALA and RALB was achieved through the transfection of MDA-MB-231 or MDA-MB-468 cells with 50 pMol of siRNA targeting human RALA (GCAGACAGCUAUCGGAAGA; Dharmacon, Lafayette, CO, USA), RALB (GAAAGAUGUUGCUUACUAU, Dharmacon) or simultaneously targeting both isoforms (GAGCUAAUGUUGACAAGGU; Dharmacon) or non-targeting control siRNA pool (D-001810-10-05, Dharmacon) using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA, USA) for 72 h. Human RALA (TL309957V) and RALB (TL309956V) targeting shRNA lentiviral particles and a non-targeting control (TR30021V) were purchased from OriGene (Rockville, MD, USA).

Techniques: In Vivo, Knockdown, Western Blot, Expressing, shRNA, Control, Comparison, Immunostaining, Quantitative RT-PCR

RALA supports, while RALB opposes, in vitro measures of aggressive cancer phenotypes in TNBC cell lines. a Representative images and quantification of MDA-MB-231 Ctrl, RALA-KO, and RALB-KO cell migration over 6 h (scale bar = 100μm). b Representative images and quantification of MDA-MB-468 siRNA control (siCtrl), siRALA, and siRALB cell migration over 6 h (scale bar = 100μm). c Representative images and quantification of MVT1 shCtrl and shRALA cell migration over 6 h (scale bar = 200μm). d Representative images and quantification of MDA-MD-231 shCtrl and shRALA scratch assay over 6 h (scale bar = 500μm). e Representative images and quantification of MDA-MB-231 Ctrl, RALA-KO, and RALB-KO cell invasion through matrigel coated transwell inserts over 24 h (scale bar = 200μm). f Representative images and quantification of MDA-MB-231 Ctrl, RALA-KO, and RALB-KO cell invasion as three dimensional spheroids over 5 days (scale bar = 400μm). g Quantification of viability for MDA-MB-231 Ctrl, RALA-KO, and RALB-KO cells ± siCtrl or siRALA/B transient knockdown over 72 h. h Quantification of viability for MDA-MB-468 siCtrl, siRALA and siRALB cells over 72 h. i Quantification of BrdU incorporation for MDA-MB-231 Ctrl, RALA-KO, and RALB-KO cells over 72 h. j Quantification of Annexin V positivity for MDA-MB-231 Ctrl, RALA-KO, and RALB-KO cells. k Quantification of growth in low adhesion (GILA) conditions for MDA-MB-231 Ctrl, RALA-KO, and RALB-KO cells ± siCtrl or siRALA/B transient knockdown over 5 days. h Quantification of growth in low adhesion (GILA) for MDA-MB-468 siCtrl, siRALA and siRALB cells over 5 days. Data are presented as mean ± SEM; (*), P < 0.05

Journal: Breast Cancer Research : BCR

Article Title: The small G-protein RalA promotes progression and metastasis of triple-negative breast cancer

doi: 10.1186/s13058-021-01438-3

Figure Lengend Snippet: RALA supports, while RALB opposes, in vitro measures of aggressive cancer phenotypes in TNBC cell lines. a Representative images and quantification of MDA-MB-231 Ctrl, RALA-KO, and RALB-KO cell migration over 6 h (scale bar = 100μm). b Representative images and quantification of MDA-MB-468 siRNA control (siCtrl), siRALA, and siRALB cell migration over 6 h (scale bar = 100μm). c Representative images and quantification of MVT1 shCtrl and shRALA cell migration over 6 h (scale bar = 200μm). d Representative images and quantification of MDA-MD-231 shCtrl and shRALA scratch assay over 6 h (scale bar = 500μm). e Representative images and quantification of MDA-MB-231 Ctrl, RALA-KO, and RALB-KO cell invasion through matrigel coated transwell inserts over 24 h (scale bar = 200μm). f Representative images and quantification of MDA-MB-231 Ctrl, RALA-KO, and RALB-KO cell invasion as three dimensional spheroids over 5 days (scale bar = 400μm). g Quantification of viability for MDA-MB-231 Ctrl, RALA-KO, and RALB-KO cells ± siCtrl or siRALA/B transient knockdown over 72 h. h Quantification of viability for MDA-MB-468 siCtrl, siRALA and siRALB cells over 72 h. i Quantification of BrdU incorporation for MDA-MB-231 Ctrl, RALA-KO, and RALB-KO cells over 72 h. j Quantification of Annexin V positivity for MDA-MB-231 Ctrl, RALA-KO, and RALB-KO cells. k Quantification of growth in low adhesion (GILA) conditions for MDA-MB-231 Ctrl, RALA-KO, and RALB-KO cells ± siCtrl or siRALA/B transient knockdown over 5 days. h Quantification of growth in low adhesion (GILA) for MDA-MB-468 siCtrl, siRALA and siRALB cells over 5 days. Data are presented as mean ± SEM; (*), P < 0.05

Article Snippet: Small interfering RNA (siRNA)-mediated knockdown of RALA and RALB was achieved through the transfection of MDA-MB-231 or MDA-MB-468 cells with 50 pMol of siRNA targeting human RALA (GCAGACAGCUAUCGGAAGA; Dharmacon, Lafayette, CO, USA), RALB (GAAAGAUGUUGCUUACUAU, Dharmacon) or simultaneously targeting both isoforms (GAGCUAAUGUUGACAAGGU; Dharmacon) or non-targeting control siRNA pool (D-001810-10-05, Dharmacon) using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA, USA) for 72 h. Human RALA (TL309957V) and RALB (TL309956V) targeting shRNA lentiviral particles and a non-targeting control (TR30021V) were purchased from OriGene (Rockville, MD, USA).

Techniques: In Vitro, Migration, Control, Wound Healing Assay, Knockdown, BrdU Incorporation Assay

RALA is elevated in TNBC and is prognostic of overall survival in ER-negative disease. a Western blots demonstrating RALA and RALB expression in a panel of BC cell lines denoted by molecular subtype. b RALA and RALB mRNA expression in a panel of 46 BC cell lines categorized according to molecular subtype. Data from the Broad Institute Cancer Cell Line Encyclopedia (CCLE), (*) P < 0.05. c Box and whisker plots of RALA and RALB expression in normal breast tissue ( n = 61), BC subtypes other than TNBC ( n = 300) , and TNBC ( n = 49). Data from TCGA Research Network. (*) P < 0.05. d Box and whisker plots of RALA and RALB expression in normal breast tissue ( n = 144), BC subtypes other than TNBC ( n = 1725), and TNBC ( n = 250). Data from METABRIC. (*) P < 0.05. e Left: Kaplan-Meier analysis segregates all BC patients by RALA (upper quartile vs lower three-quartiles) and RALB (spilt along the median) expression in METABRIC and TCGA datasets wherein high RALA is prognostic of worse disease specific survival (DSS) in the METABRIC ( P = 0.0079) and overall survival in the TCGA ( P = 0.0003) cohorts and low RALB is prognostic of worse DSS in the METABRIC cohort ( P = 0.0311), but is not prognostic in the TCGA cohort ( P = 0.9477). Right: Within the TNBC population of the METABRIC cohort, RALA (upper tenth percentile vs lower 90th percentail) is prognostic of worse DSS TNBC patients ( P = 0.0544) while RALB (spilt along the median) is not prognostic ( P = 0.9297). Significance determined by log-rank. f Top: Representative high and low RALA immunostaining of BC patient samples. Bottom: Kaplan-Meier analysis segregating all BC patients ( P = 0.0417) and TNBC patients ( P = 0.0440) by RALA H-score (upper tertile vs lower two tertiles) where high RALA is prognostic of worse overall survival (Scale bars = 60μm)

Journal: Breast Cancer Research : BCR

Article Title: The small G-protein RalA promotes progression and metastasis of triple-negative breast cancer

doi: 10.1186/s13058-021-01438-3

Figure Lengend Snippet: RALA is elevated in TNBC and is prognostic of overall survival in ER-negative disease. a Western blots demonstrating RALA and RALB expression in a panel of BC cell lines denoted by molecular subtype. b RALA and RALB mRNA expression in a panel of 46 BC cell lines categorized according to molecular subtype. Data from the Broad Institute Cancer Cell Line Encyclopedia (CCLE), (*) P < 0.05. c Box and whisker plots of RALA and RALB expression in normal breast tissue ( n = 61), BC subtypes other than TNBC ( n = 300) , and TNBC ( n = 49). Data from TCGA Research Network. (*) P < 0.05. d Box and whisker plots of RALA and RALB expression in normal breast tissue ( n = 144), BC subtypes other than TNBC ( n = 1725), and TNBC ( n = 250). Data from METABRIC. (*) P < 0.05. e Left: Kaplan-Meier analysis segregates all BC patients by RALA (upper quartile vs lower three-quartiles) and RALB (spilt along the median) expression in METABRIC and TCGA datasets wherein high RALA is prognostic of worse disease specific survival (DSS) in the METABRIC ( P = 0.0079) and overall survival in the TCGA ( P = 0.0003) cohorts and low RALB is prognostic of worse DSS in the METABRIC cohort ( P = 0.0311), but is not prognostic in the TCGA cohort ( P = 0.9477). Right: Within the TNBC population of the METABRIC cohort, RALA (upper tenth percentile vs lower 90th percentail) is prognostic of worse DSS TNBC patients ( P = 0.0544) while RALB (spilt along the median) is not prognostic ( P = 0.9297). Significance determined by log-rank. f Top: Representative high and low RALA immunostaining of BC patient samples. Bottom: Kaplan-Meier analysis segregating all BC patients ( P = 0.0417) and TNBC patients ( P = 0.0440) by RALA H-score (upper tertile vs lower two tertiles) where high RALA is prognostic of worse overall survival (Scale bars = 60μm)

Article Snippet: Small interfering RNA (siRNA)-mediated knockdown of RALA and RALB was achieved through the transfection of MDA-MB-231 or MDA-MB-468 cells with 50 pMol of siRNA targeting human RALA (GCAGACAGCUAUCGGAAGA; Dharmacon, Lafayette, CO, USA), RALB (GAAAGAUGUUGCUUACUAU, Dharmacon) or simultaneously targeting both isoforms (GAGCUAAUGUUGACAAGGU; Dharmacon) or non-targeting control siRNA pool (D-001810-10-05, Dharmacon) using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA, USA) for 72 h. Human RALA (TL309957V) and RALB (TL309956V) targeting shRNA lentiviral particles and a non-targeting control (TR30021V) were purchased from OriGene (Rockville, MD, USA).

Techniques: Western Blot, Expressing, Whisker Assay, Immunostaining

Figure 1. MLH1 Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 1. MLH1 Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Binding Assay, Western Blot, Phospho-proteomics, Quantitative RT-PCR

Figure 2. Exo1 is Essential for Innate Sensing Signaling in Mlh1–/– 4T1 Cells (A) Depletion of Exo1 reduces cytosolic DNA accumulation in Mlh1/ cells regardless of IR treatment. (B) Western blots showing reduced DNA breaks and pSTAT1 when Exo1 was depleted from Mlh1/ cells. A non-specific band detected by an Exo1 antibody is indicated by an asterisk. (C) Quantification of the relative gH2AX levels in Mlh1 knockout and Mlh1-Exo1 double-knockout (Dbl KO) cells. (D) Western blots showing that Exo1 knockout abolishes IR-induced STING activation. (E) Quantification of relative pSTING levels in Mlh1- knockout and Mlh1-Exo1 Dbl KO cells. (F) qRT-PCR analysis showing that Exo1 depletion suppressed expression of Isg15. Data represent the mean ± SEM of three inde- pendent experiments (A, C, and E) or three repli- cates (F). p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S2.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 2. Exo1 is Essential for Innate Sensing Signaling in Mlh1–/– 4T1 Cells (A) Depletion of Exo1 reduces cytosolic DNA accumulation in Mlh1/ cells regardless of IR treatment. (B) Western blots showing reduced DNA breaks and pSTAT1 when Exo1 was depleted from Mlh1/ cells. A non-specific band detected by an Exo1 antibody is indicated by an asterisk. (C) Quantification of the relative gH2AX levels in Mlh1 knockout and Mlh1-Exo1 double-knockout (Dbl KO) cells. (D) Western blots showing that Exo1 knockout abolishes IR-induced STING activation. (E) Quantification of relative pSTING levels in Mlh1- knockout and Mlh1-Exo1 Dbl KO cells. (F) qRT-PCR analysis showing that Exo1 depletion suppressed expression of Isg15. Data represent the mean ± SEM of three inde- pendent experiments (A, C, and E) or three repli- cates (F). p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S2.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Western Blot, Knock-Out, Double Knockout, Activation Assay, Quantitative RT-PCR, Expressing

Figure 3. MutLa Regulates Exo1 Nuclease Activity (A) Diagram of major functional domains in Exo1. (B) Co-immunoprecipitation/western blot analysis of MutLa interactions with WT and mutant Exo1 (right) using purified proteins (left). (C) Southern blot analysis determining the impact of the MutLa–Exo1 interaction on mismatch-provoked excision in a purified MMR system. The excision products were digested with SspI and processed for Southern blot analysis, as described in STAR Methods. Schematic representation of the 50 G-T heteroduplex after SspI digestion is shown on the right side of the gel. Positions of the nick and mismatch (red asterisk) are 544 bp and 416 bp away, respectively, from the bottom SspI site. Red bar indicates the 32P-labeled oligonucleotide probe, which is complementary to the nicked strand near the bottom SspI site. Red bracket shows mismatch-provoked excision products terminated upon mismatch removal in reactions with WT Exo1 but not in those with Exo1-FF-AA. (D) In vitro end-resection assay to determine the impact of the MutLa-Exo1 interaction on Exo1-catalyzed resection using purified proteins and a linearized 2.7-kb pUC19 plasmid DNA. MutLa concentration was 1 pmol (lower) or 4 pmol (higher). (E) Percentage of end-resection product II shown in (D) in three independent assays. (F) In vitro end-resection assay to determine the role of RPA in Exo1-catalyzed resection. The MutLa concentrations used in titration were 1 pmol, 2 pmol and 4 pmol. (G) Principle of in vivo end-resection assay. (H) qPCR analysis determining the amount of ssDNA generated at a specific DBS site (AsiSI) in WT and MLH1/ U2OS cells. Data represent the mean ± SEM of three independent experiments (E) or three replicates (H). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 3. MutLa Regulates Exo1 Nuclease Activity (A) Diagram of major functional domains in Exo1. (B) Co-immunoprecipitation/western blot analysis of MutLa interactions with WT and mutant Exo1 (right) using purified proteins (left). (C) Southern blot analysis determining the impact of the MutLa–Exo1 interaction on mismatch-provoked excision in a purified MMR system. The excision products were digested with SspI and processed for Southern blot analysis, as described in STAR Methods. Schematic representation of the 50 G-T heteroduplex after SspI digestion is shown on the right side of the gel. Positions of the nick and mismatch (red asterisk) are 544 bp and 416 bp away, respectively, from the bottom SspI site. Red bar indicates the 32P-labeled oligonucleotide probe, which is complementary to the nicked strand near the bottom SspI site. Red bracket shows mismatch-provoked excision products terminated upon mismatch removal in reactions with WT Exo1 but not in those with Exo1-FF-AA. (D) In vitro end-resection assay to determine the impact of the MutLa-Exo1 interaction on Exo1-catalyzed resection using purified proteins and a linearized 2.7-kb pUC19 plasmid DNA. MutLa concentration was 1 pmol (lower) or 4 pmol (higher). (E) Percentage of end-resection product II shown in (D) in three independent assays. (F) In vitro end-resection assay to determine the role of RPA in Exo1-catalyzed resection. The MutLa concentrations used in titration were 1 pmol, 2 pmol and 4 pmol. (G) Principle of in vivo end-resection assay. (H) qPCR analysis determining the amount of ssDNA generated at a specific DBS site (AsiSI) in WT and MLH1/ U2OS cells. Data represent the mean ± SEM of three independent experiments (E) or three replicates (H). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Activity Assay, Functional Assay, Immunoprecipitation, Western Blot, Mutagenesis, Southern Blot, Labeling, In Vitro, Resection Assay, Plasmid Preparation, Concentration Assay, Titration, In Vivo, Generated

Figure 4. Exo1 Recruitment, Abundance, and Stability in MLH1–/– Cells (A) Live cell imaging showing real-time recruitment and retention dynamics of GFP-tagged Exo1 after laser microirradiation in WT and MLH1/ HeLa cells. The scale bars are 5 mm. (B) Quantification of GFP-tagged Exo1 levels from the indicated number of cells. (C) Western blots showing whole cell lysate (WCL) and chromatin-bound levels of Exo1 and phos- phorylated Exo1 (pExo1) in WT and MLH1/ HeLa cells. (D) Quantification of relative total Exo1 levels in WT and MLH1/ HeLa cells. (E) Western blots showing WCL levels of Exo1 in WT and MLH1/ U2OS cells. (F) RNA-sequencing data from the TCGA database showing significantly higher Exo1 expression in dMLH1 tumors than in MSS tumors. (G) Quantification of relative pExo1 levels in WCL (upper) and on chromatin (lower) in WT and MLH1/ HeLa cells. Data represent the mean ± SEM of three inde- pendent experiments. p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S3.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 4. Exo1 Recruitment, Abundance, and Stability in MLH1–/– Cells (A) Live cell imaging showing real-time recruitment and retention dynamics of GFP-tagged Exo1 after laser microirradiation in WT and MLH1/ HeLa cells. The scale bars are 5 mm. (B) Quantification of GFP-tagged Exo1 levels from the indicated number of cells. (C) Western blots showing whole cell lysate (WCL) and chromatin-bound levels of Exo1 and phos- phorylated Exo1 (pExo1) in WT and MLH1/ HeLa cells. (D) Quantification of relative total Exo1 levels in WT and MLH1/ HeLa cells. (E) Western blots showing WCL levels of Exo1 in WT and MLH1/ U2OS cells. (F) RNA-sequencing data from the TCGA database showing significantly higher Exo1 expression in dMLH1 tumors than in MSS tumors. (G) Quantification of relative pExo1 levels in WCL (upper) and on chromatin (lower) in WT and MLH1/ HeLa cells. Data represent the mean ± SEM of three inde- pendent experiments. p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S3.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Live Cell Imaging, Western Blot, RNA Sequencing, Expressing

Figure 5. RPA Exhaustion and Aberrant Resection Intermediates in MLH1–/– Cells (A) Microscope imaging showing BrdU incorporation by DNA polymerase using hype-resection-generated unprotected RPA as a template for DNA synthesis in the RPA exhaustion assay. ssDNA binding by phosphorylated RPA (pRPA) is also shown. (B and C) Quantification of BrdU foci/cell (B) and percentage of cells exhibiting BrdU foci (C) in WT and MLH1/ U2OS cells. (D) Quantification of pRPA foci per cell. (E) Western blots detecting pRPA and its association with DNA break marker gH2AX in the indicated cells before and after IR. (F) Quantification of relative pRPA levels shown in (E), with three independent assays. (G) Immunofluorescence confocal analysis showing large RPA foci in HeLa MLH1/ cells. (H) Quantification and comparison of the percentage of WT and MLH1/ cells displaying RPA foci. (I) Immunofluorescence confocal analysis showing large Rad51 foci in MLH1/ HeLa cells. (J) Quantification of RAD51 foci/nucleus in various HeLa cells, as indicated. (K) Immunofluorescence confocal analysis showing large Rad51 foci in HCT116 and MLH1-rescued HCT116 cells. Data represent the mean ± SEM of three independent experiments (C, F, and H) or the indicated number of cells (B, D, and J). p values were calculated using one- way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 5. RPA Exhaustion and Aberrant Resection Intermediates in MLH1–/– Cells (A) Microscope imaging showing BrdU incorporation by DNA polymerase using hype-resection-generated unprotected RPA as a template for DNA synthesis in the RPA exhaustion assay. ssDNA binding by phosphorylated RPA (pRPA) is also shown. (B and C) Quantification of BrdU foci/cell (B) and percentage of cells exhibiting BrdU foci (C) in WT and MLH1/ U2OS cells. (D) Quantification of pRPA foci per cell. (E) Western blots detecting pRPA and its association with DNA break marker gH2AX in the indicated cells before and after IR. (F) Quantification of relative pRPA levels shown in (E), with three independent assays. (G) Immunofluorescence confocal analysis showing large RPA foci in HeLa MLH1/ cells. (H) Quantification and comparison of the percentage of WT and MLH1/ cells displaying RPA foci. (I) Immunofluorescence confocal analysis showing large Rad51 foci in MLH1/ HeLa cells. (J) Quantification of RAD51 foci/nucleus in various HeLa cells, as indicated. (K) Immunofluorescence confocal analysis showing large Rad51 foci in HCT116 and MLH1-rescued HCT116 cells. Data represent the mean ± SEM of three independent experiments (C, F, and H) or the indicated number of cells (B, D, and J). p values were calculated using one- way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Microscopy, Imaging, BrdU Incorporation Assay, Generated, DNA Synthesis, Binding Assay, Western Blot, Marker, Comparison

Figure 6. Chromosomal Abnormalities in MLH1–/– Cells (A–D) Chromosomal spreading analysis to deter- mine metaphase chromosomal breaks and other aberrations in 4T1 cells (A and C) and Mlh1/ 4T1 cells (B and D) with (C and D) and without (A and B) IR treatment. Chromosome breaks are indicated by green arrows while unresolved chromosomes are indicated by blue arrows. (E) Percentage of WT and Mlh1/ 4T1 cells con- taining the indicated number of chromosome ab- normalities. (F and G) Average number of chromosomal ab- normalities in WT and Mlh1/ 4T1 (F) and HeLa (G) cells. (H) Average number of chromosomal abnormal- ities in HCT116 and MLH1-rescued HCT116 cells. ***p < 0.001; ****p < 0.0001.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 6. Chromosomal Abnormalities in MLH1–/– Cells (A–D) Chromosomal spreading analysis to deter- mine metaphase chromosomal breaks and other aberrations in 4T1 cells (A and C) and Mlh1/ 4T1 cells (B and D) with (C and D) and without (A and B) IR treatment. Chromosome breaks are indicated by green arrows while unresolved chromosomes are indicated by blue arrows. (E) Percentage of WT and Mlh1/ 4T1 cells con- taining the indicated number of chromosome ab- normalities. (F and G) Average number of chromosomal ab- normalities in WT and Mlh1/ 4T1 (F) and HeLa (G) cells. (H) Average number of chromosomal abnormal- ities in HCT116 and MLH1-rescued HCT116 cells. ***p < 0.001; ****p < 0.0001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques:

Figure 7. Model for MLH1–/–-Mediated cGAS Activation and Immunotherapy MutLa (MLH1-PMS2) properly terminates Exo1- catalyzed end resection, which facilitates DSB repair by HR (left). However, depleting MLH1 de- prives cells of MutLa, allowing Exo1 to conduct uncontrolled excision. This hyper-resection gen- erates a large quantity of ssDNA that exhausts the RPA pool, leaving the ssDNA chain unprotected. The unprotected ssDNA can be digested or nicked by various nucleases in the nucleus, which leads to abnormal recombination intermediates and chro- mosome breaks. The latter can trigger cells to degrade a part or all of the damaged chromosome to release nuclear DNA into the cytoplasm, acti- vating the cGAS-STING pathway and the down- stream immune responses. Together with the large number of neoantigens generated from mutations caused by MLH1 deficiency, the immune signaling activated by Exo1 hyper-resection facilitates immunotherapy.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 7. Model for MLH1–/–-Mediated cGAS Activation and Immunotherapy MutLa (MLH1-PMS2) properly terminates Exo1- catalyzed end resection, which facilitates DSB repair by HR (left). However, depleting MLH1 de- prives cells of MutLa, allowing Exo1 to conduct uncontrolled excision. This hyper-resection gen- erates a large quantity of ssDNA that exhausts the RPA pool, leaving the ssDNA chain unprotected. The unprotected ssDNA can be digested or nicked by various nucleases in the nucleus, which leads to abnormal recombination intermediates and chro- mosome breaks. The latter can trigger cells to degrade a part or all of the damaged chromosome to release nuclear DNA into the cytoplasm, acti- vating the cGAS-STING pathway and the down- stream immune responses. Together with the large number of neoantigens generated from mutations caused by MLH1 deficiency, the immune signaling activated by Exo1 hyper-resection facilitates immunotherapy.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Activation Assay, Immunopeptidomics, Generated

Figure 4: Loss of Lats and YAP Phosphorylation, Increased TAZ Levels with PCBP2 652

Journal: Molecular and Cellular Biology

Article Title: Poly(rC)-Binding Protein 2 Regulates Hippo Signaling To Control Growth in Breast Epithelial Cells

doi: 10.1128/mcb.00104-16

Figure Lengend Snippet: Figure 4: Loss of Lats and YAP Phosphorylation, Increased TAZ Levels with PCBP2 652

Article Snippet: TAZ and YAP were depleted using siRNA from Origene.

Techniques: Phospho-proteomics

Figure 7: Requirement of YAP and TAZ for PCBP2-mediated Changes in Transcription. 701

Journal: Molecular and Cellular Biology

Article Title: Poly(rC)-Binding Protein 2 Regulates Hippo Signaling To Control Growth in Breast Epithelial Cells

doi: 10.1128/mcb.00104-16

Figure Lengend Snippet: Figure 7: Requirement of YAP and TAZ for PCBP2-mediated Changes in Transcription. 701

Article Snippet: TAZ and YAP were depleted using siRNA from Origene.

Techniques: